rs685190 chr12:52641676 C>T
- Sequence
ctagaccataaatccctgacagga[C/T]gcactgtcttataagtcttgatac
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -3.41 | 3.30 | 1.00 | 2.94 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP alzheimers disease (apoe4 homozygotes), hypertension (early onset hypertension), intracranial aneurysm, salmonella-induced pyroptosis, schizophrenia, sporadic creutzfeldt-jakob disease, transmission distortion, variant creutzfeldt-jakob disease, years of education
GTEx eQTL Adipose_Subcutaneous, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood