rs685557 chr1:234691930 C>T
- Sequence
cccaggtatgggattgctaaatac[C/T]gccagattgctctctggagtgtct
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 2.33 | -2.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, triglycerides change with statins, years of education
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Esophagus_Mucosa, Liver, Lung, Small_Intestine_Terminal_Ileum, Testis