rs686007 chr2:233857607 A>G
- Sequence
tggaatctcacagggtttccagag[A/G]tgacggcgggtggctccggctgcc
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.10 | 2.19 | 1.50 | |||
| WA01 (H1, human embryonic stem cells) | 1.29 | -0.07 | 1.21 |
Items per page:
1 – 2 of 2