rs688878 chr11:67572478 G>A
- Sequence
agagccagtaaaaagtcccttgga[G/A]agattggtctggtacctggttttt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.31 | 2.65 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, asthma, autism, autism with verbal ability, body mass index (bmi), ldl cholesterol change with statins, lung function, predicted forced vital capacity (fvc), paternal transmission distortion, total cholesterol change with statins