rs689439 chr16:825402 T>C
- Sequence
acgcgtggcccccaccccttccca[T/C]gtggcttcgtgctgtgagccacaa
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -3.40 | 2.14 | 1.33 | 3.00 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) (in asthmatic participants), total cholesterol