rs690423 chr18:76406028 G>A
- Sequence
tccacacgggaggcgtgctcaagc[G/A]tcctcagcaggcccagctgtcatc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) upper lobe of left lung gastrocnemius medialis
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.83 | -0.06 | 1.50 | -2.65 | Concordant | |||
| STAG1_HUMAN | 2.01 | -1.31 | 1.80 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
