rs690593 chr18:76448452 C>G
- Sequence
cctgacacacgccccggtaagctg[C/G]tgaaacacttcccggtgtgaagaa
- ASB in cell types
- macrophages form periferal blood NOMO-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 0.16 | 2.67 | 2.00 | |||
| NOMO-1 (acute monocytic leukemia) | -0.45 | 1.24 | 1.00 |
Items per page:
1 – 2 of 2