rs691130 chr7:134141695 T>G
- Sequence
agatcatctttcaggagagtctgg[T/G]ggtcccgtgaagttagtagagttg
- ASB in cell types
- K562 (myelogenous leukemia) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.05 | 0.46 | 1.49 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.04 | -0.55 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, height, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis