rs693235 chr11:64725290 A>C
- Sequence
acctgccacttcaagacacacccc[A/C]cacacacacacaccacacacaggt
- ASB in cell types
- YCC3 (gastric adenocarcinoma)
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.47 | -0.36 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, height, hypertension (early onset hypertension), neuroblastoma (brain cancer), pulse pressure, variant creutzfeldt-jakob disease, waist hip ratio