rs693884 chr11:74434483 T>C
- Sequence
ccacagctgtacatgaaaatatgg[T/C]taaatctctgatatggttaggctt
- ASB in cell types
- HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | 2.28 | -1.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1