rs6956158 chr7:5174572 C>T
- Sequence
acatgtgcagcctcttgtccaatc[C/T]tgccctgtccgccccactcctcta
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) adrenal gland upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.12 | 1.13 | 1.00 | |||
| adrenal gland | 1.64 | -1.40 | 1.00 | |||
| upper lobe of left lung | 2.06 | n/a | 1.00 |
Items per page:
1 – 3 of 3