rs6957102 chr7:155230532 C>T
- Sequence
attcttgtgatcttggcagtgcct[C/T]acgaaacacaacctacaccacatc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMRC1_HUMAN SMAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 1.80 | -1.41 | 1.00 | n/a | n/a | |||
| SMAD3_HUMAN | 0.36 | 1.82 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, refractive error
GTEx eQTL Adipose_Subcutaneous, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg