rs6958004 chr7:134755649 A>G
- Sequence
gtacagtacacagcctgcacagcc[A/G]taactggcagtcagcttttgtttg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.14 | 1.03 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.00 | -0.91 | 1.00 |
Items per page:
1 – 2 of 2