rs6958168 chr7:44980215 T>G
- Sequence
tttgttgtactcataagcactagt[T/G]taactattgtctttcagtcatccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 0.82 | 1.14 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), college completion, transmission distortion, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood