rs6958350 chr7:25832313 C>T
- Sequence
tcgggttgacaagactgctttcct[C/T]tctctctaagccgggttgtgtttg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | 2.34 | -1.38 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI waist-to-hip ratio adjusted for bmi, waist-to-hip ratio adjusted for bmi (age <50), waist-to-hip ratio adjusted for bmi (age >50), waist-to-hip ratio adjusted for bmi x sex x age interaction (4df test)
GRASP advanced age-related macular degeneration (geographic atrophy), maternal transmission distortion, triglycerides, waist hip ratio