rs6960659 chr7:4361993 C>A
- Sequence
aaggcaagaataaattctccctgc[C/A]tcctccaggggaagcacggtccca
- ASB in cell types
- thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thoracic aorta | 2.98 | n/a | 1.00 |
Items per page:
1 – 1 of 1