rs6962189 chr7:20715352 A>C
- Sequence
gagccgccgcgcatggcctctact[A/C]cttacttcatttccttttgcttta
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.03 | 2.01 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1