rs6962285 chr7:35537380 G>A
- Sequence
caccccccggggcagagcattgcc[G/A]ggtgagccgcatccctgcctggaa
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.13 | 1.90 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.54 | -2.99 | 2.00 |
Items per page:
1 – 2 of 2