rs6962286 chr7:35537381 G>A
- Sequence
accccccggggcagagcattgccg[G/A]gtgagccgcatccctgcctggaac
- ASB in cell types
- GBM39 (Human brain tumor) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GBM39 (Human brain tumor) | 1.66 | -3.10 | 2.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.06 | 1.61 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, mitral annular calcium, obesity with early age of onset (age >2)