rs6963084 chr7:113653063 G>C
- Sequence
cgtggggattcagaggattatcag[G/C]attaaggggattacagttcaagag
- ASB in cell types
- D341 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.76 | -0.35 | 1.00 | -4.33 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
