rs6964381 chr7:155230491 A>G
- Sequence
ttgtggaggtcagagtcattgatc[A/G]tcataaaaacagtcacattcttgt
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) SK-N-SH (neuroblastoma) GM23248 RH4 (alveolar rhabdomyosarcoma)
- ASB for transcription factors
- PBX3_HUMAN SMRC1_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX3_HUMAN | 3.07 | -4.05 | 2.00 | 1.61 | Weak Discordant | |||
| SMRC1_HUMAN | 1.84 | -1.02 | 1.00 | n/a | n/a | |||
| EZH2_HUMAN | 2.41 | -2.01 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, refractive error, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg