rs6964628 chr7:153843132 T>G
- Sequence
gtgcatacacatgcgcatacacac[T/G]tgcatacagacacgtgcatgcaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -1.56 | 1.56 | 1.00 | 4.65 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
