rs6964631 chr7:108489440 C>T
- Sequence
gccaggaatgctgctactcaatgg[C/T]cttcacattgacatctcaaatctc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MAFG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFG_HUMAN | -2.77 | 1.77 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, autism without verbal ability, fasting insulin, homa-ir, neuroblastoma (brain cancer), schizophrenia, sporadic creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg