rs6965420 chr7:108003456 T>G
- Sequence
cgtgggggcgtctccgaggtgggt[T/G]ttcaggttgcccagccagggggcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | n/a | 2.81 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1