rs6965471 chr7:127459522 G>T
- Sequence
tgagccacagcattactggacttg[G/T]ggtgccccctaatgcagatatggc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.50 | -1.02 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.68 | -0.39 | 1.00 |
Items per page:
1 – 2 of 2