rs6965592 chr7:121182505 C>A
- Sequence
cttcctttctttcctccttctttg[C/A]ctccctctcttcctccctcccttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.66 | 1.60 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bone thickness, bone strength, osteoporotic fracture risk, hdl cholesterol, infant head circumference, waist hip ratio