rs6968780 chr7:154842227 A>G
- Sequence
attcaccaatgcttaagagatatc[A/G]gtggtgccagccaggctgtttgaa
- ASB in cell types
- 22RV1 (prostate carcinoma) HS-SY-2(Monophasic synovial sarcoma) RH4 (alveolar rhabdomyosarcoma)
- ASB for transcription factors
- ANDR_HUMAN MYOD1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.26 | n/a | 2.00 | n/a | No Hit | |||
| MYOD1_HUMAN | 0.72 | 1.63 | 1.33 | n/a | No Hit | |||
| SMCA4_HUMAN | -0.14 | 1.36 | 1.12 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, fasting blood glucose, hip bone mineral density (bmd), homa-ir, ldl cholesterol, obesity with early age of onset (age >2)