rs6968828 chr7:27183944 G>T
- Sequence
ttgttcttttaatatattgctaga[G/T]ctaagcgggctactttatctgtta
- ASB in cell types
- Hep 3B2.1-7 (HEP-3B, Hepatocellular carcinoma) embryonic stem cells
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.73 | 1.60 | 1.08 | n/a | n/a |
Items per page:
1 – 1 of 1