rs6969424 chr7:64201 A>C
- Sequence
ggacccatcactaaggaataaacc[A/C]gcagctctccacgagggggcacag
- ASB in cell types
- A549 (lung carcinoma) T47D (invasive ductal carcinoma) upper lobe of left lung RH4 (alveolar rhabdomyosarcoma)
- ASB for transcription factors
- RAD21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.25 | 1.40 | 1.64 | n/a | n/a | |||
| CTCF_HUMAN | 0.60 | 1.20 | 1.53 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP major depressive disorder, prop taste detection threshold, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood