rs6970732 chr7:157436834 T>C
- Sequence
gaattggtgggaggtggcctggga[T/C]ggttagcactgagtggccccccac
- ASB in cell types
- AML (monocytes and acute myeloid leukemia)
- ASB for transcription factors
- MYB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYB_HUMAN | -0.72 | 1.47 | 1.50 | 5.22 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
