rs6971331 chr7:57308827 T>C
- Sequence
tgctaggaacacatttcttgcctg[T/C]tgtgggagctgggagccggctggg
- ASB in cell types
- adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.14 | 0.87 | 1.40 | 0.19 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
