rs697266 chr3:64139963 G>C
- Sequence
atcatacaattggatggttactgt[G/C]tatcaacttcactagactgtgagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.19 | n/a | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, barnes akathisia rating scale, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), rheumatoid arthritis, serum adipocyte fatty acid-binding protein levels in non-diabetics, simpson-angus scale