rs6973541 chr7:73996078 G>T
- Sequence
ctaagctgcctcaggggggctgat[G/T]ggcaggtattataagcaggttgca
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -0.09 | 1.77 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1