rs697370 chr10:123538205 T>A
- Sequence
tggggattaggtgtcaacttatga[T/A]tttgcagggggcacaaataatcag
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- ENL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | n/a | 3.77 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins