rs6977395 chr7:31938418 T>C
- Sequence
agagagcaggcaaaccagataagc[T/C]ggaaggggtggggggctgggaggg
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.35 | 1.64 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-ir, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), triglycerides change with statins