rs6979000 chr7:51606441 A>C
- Sequence
ttagtgaattgaagggttttggac[A/C]tgacttcaaaccatcttaacgtgt
- ASB in cell types
- CWR22 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | -0.81 | 1.90 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), hdl cholesterol, ldl cholesterol change with statins, total cholesterol