rs6980819 chr8:9831079 G>A
- Sequence
gatagaagtaggtgctgacctcta[G/A]tggacatgtgtagcaatacagctc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.67 | 0.56 | 1.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 0.93 | -0.01 | 2.00 |
Items per page:
1 – 2 of 2