rs6981043 chr8:124450745 G>C
- Sequence
accataaaaaagatggcggccgca[G/C]cttctccacagcaacggcaacgcc
- ASB in cell types
- MDM(monocyte derived macrophages) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.37 | n/a | 3.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.34 | -0.90 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), birth weight, obesity with early age of onset (age >2), total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Thyroid, Whole_Blood