rs6981265 chr8:80115643 T>A
- Sequence
actaactcctggaagactgctgta[T/A]ccccaaaacataaacttaactgtg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 2.05 | -1.51 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -1.74 | 2.05 | 1.00 |
Items per page:
1 – 2 of 2