rs6982080 chr8:29773426 G>T
- Sequence
aagaggagagacagttgacgagac[G/T]tgaagtctgattactgttactgca
- ASB in cell types
- macrophages GM12878 (female B-cells lymphoblastoid cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.21 | -0.67 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, fasting blood glucose, hdl cholesterol, prostate cancer aggressiveness