rs698237 chr3:22960629 C>T
- Sequence
agcaactaggaagcttttctttct[C/T]tctttctttctttttttttttaac
- ASB in cell types
- MS-1 (Small cell lung carcinoma) A549 (lung carcinoma) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.01 | 0.81 | 1.00 | |||
| A549 (lung carcinoma) | 0.75 | 0.13 | 1.97 | |||
| adrenal gland | 1.44 | -1.26 | 1.00 |
Items per page:
1 – 3 of 3