rs6982502 chr8:125467120 C>T
- Sequence
gcctccttcctgcttctgagacca[C/T]ggcctctgatctcacctctttaga
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.08 | 1.20 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI coronary artery disease, hypertriglyceridemia, serum total protein level, total cholesterol levels
GRASP 2 hour glucose, adiponectin levels, advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad), eye color, hdl cholesterol, hdl cholesterol (median hdl cholesterol), hdl cholesterol (modeled hdl cholesterol), height, ldl cholesterol, ldl cholesterol change with statins, serum creatinine, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins