rs6983267 chr8:127401060 G>T
- Sequence
tcctttgagctcagcagatgaaag[G/T]cactgagaaaagtacaaagaattt
- ASB in cell types
- iPS-derived dermal fibroblasts 22RV1 (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN CTNB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.30 | 1.48 | 1.83 | n/a | No Hit | |||
| CTNB1_HUMAN | 2.13 | -1.48 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI colorectal cancer, colorectal cancer or advanced adenoma, prostate cancer, prostate cancer (early onset)
GRASP adenoma, adenoma (female), colorectal cancer, colorectal tumors, infant head circumference, ovarian cancer, prostate cancer, prostate cancer (advanced prostate cancer), prostate cancer (non-advanced prostate cancer), prostate cancer aggressiveness, prostate cancer early age of onset, total cholesterol
PheWAS abnormal loss of weight and underweight, abnormal results of function studies, acquired deformities of finger, acquired deformities of limbs, acquired spondylolisthesis, acute cystitis, acute prostatitis, agorophobia, social phobia, and panic disorder, aneurysm and dissection of heart, aneurysm of other specified artery, arterial embolism and thrombosis, atherosclerosis of native arteries of the extremities with intermittent claudication, benign neoplasm of bone and articular cartilage, benign neoplasm of colon, cancer of brain and nervous system, cancer of larynx, cancer of mouth, cancer of the lower gi tract, cardiac arrest & ventricular fibrillation, cardiac defibrillator in situ, cellulitis and abscess of face, chronic lymphocytic thyroiditis, chronic lymphoid leukemia, colorectal cancer, diseases of white blood cells, dyspareunia, dysphagia, elevated c-reactive protein, elevated sedimentation rate, elevated white blood cell count, first degree av block, gastrointestinal complications, hemorrhage of rectum and anus, hyperbilirubinemia, inflammatory and toxic neuropathy, intracranial hemorrhage, joint effusions, lymphoid leukemia, mastoiditis, other disorders of intestine, paralysis/spasm of vocal cords or larynx, premenstrual tension syndromes, prostate cancer, retinal detachment with retinal defect, retinal detachments and defects, secondary/extrinsic cardiomyopathies, senile dementia, spontaneous ecchymoses, subdural hemorrhage, suppurative and unspecified otitis media, symptoms associated with female genital organs, symptoms of the muscles, syncope and collapse, thyroiditis, urinary obstruction, uterine cancer, varicose veins