rs6983504 chr8:8995335 A>G
- Sequence
ctctggccagtctatagagaatgc[A/G]cagaggattttcggtcctctgctt
- ASB in cell types
- BEAS-2B (bronchial epithelium) monocyte-derived macrophages from peripheral blood CD14+ monocytes
- ASB for transcription factors
- GCR_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.47 | n/a | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.60 | -0.37 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2