rs6984305 chr8:9320758 A>T
- Sequence
tctactctgaattgcttagcagtc[A/T]tacaactagagggcagccttcagc
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.04 | 1.76 | 1.68 | 1.74 | Weak Concordant | |||
| STAG1_HUMAN | -0.10 | 1.87 | 1.48 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, alanine aminotransferase (alt) in plasma, alkaline phosphatase (alp) in plasma, fasting blood glucose, fasting insulin, gamma-glutamyl transferase (ggt), hdl cholesterol, hepatic steatosis assessed by ct, homa-ir, ldl cholesterol, ppp1r3b gene expression in liver, suicide attempts in bipolar disorder (females), total cholesterol