rs6985426 chr8:31286282 A>G
- Sequence
gttggaagcggaccaacagttaca[A/G]tgttctgtgtgctgctggctgctt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- TF65_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | n/a | 3.30 | 2.50 | n/a | No Hit | |||
| GCR_HUMAN | -1.12 | 2.16 | 2.00 | -2.02 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, years of education