rs6985838 chr8:140791089 G>C
- Sequence
tgtaaagtttgcttcatttattta[G/C]tttcctttatctgttaacacttgc
- ASB in cell types
- LNCaP (prostate carcinoma) Detroit 562 (Pharyngeal squamous cell carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.61 | 1.72 | 1.56 | 5.48 | Concordant | |||
| TF65_HUMAN | 0.27 | 1.59 | 2.77 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, coronary artery calcification (cac), diastolic blood pressure (dbp), height, systolic blood pressure (sbp)
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Skin_Not_Sun_Exposed_Suprapubic