rs6986393 chr8:54382307 T>A
- Sequence
caatggtattatctcaagccaacc[T/A]cggctgcagaaactcgcaatgctt
- ASB in cell types
- HEK293 (embryonic kidney) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.30 | 0.77 | 1.29 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.25 | n/a | 3.50 |
Items per page:
1 – 2 of 2