rs6987078 chr8:102032733 G>A
- Sequence
tcatgtgcatgctcacaaaaggac[G/A]tccactgcagagaaggctgtcaat
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.27 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, major depressive disorder, major depressive disorder (females), parkinsons disease, recurrent early onset major depressive disorder, total cholesterol