rs698768 chr2:44349410 C>T
- Sequence
ggtttctacaggccacattttgga[C/T]aactggagcctcaaaaagaataat
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.91 | 1.88 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, resistance to kuru in aged women despite likely exposure
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Pituitary